The following mature miRNA have the same seed sequence: UAUAAUA
| ID | hsa-miR-374a-5p |
| Accession | MIMAT0000727 |
| Sequence | 12 - UUAUAAUACAACCUGAUAAGUG - 33 |
| Seed Sequence | UAUAAUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- vulvar melanoma
- vulva cancer
- HER2 negative hormone receptor negative breast cancer
- systemic sclerosis
- sporadic amyotrophic lateral sclerosis
- LMNA-related congenital muscular dystrophy
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
role in cell
- expression in
- proliferation
- migratory capacity