The following mature miRNA have the same seed sequence: GCAUCCC
| ID | hsa-miR-324-5p |
| Accession | MIMAT0000761 |
| Sequence | 16 - CGCAUCCCCUAGGGCAUUGGUG - 37 |
| Seed Sequence | GCAUCCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast carcinoma
- colorectal cancer
- vulvar melanoma
- vulva cancer
- spinal muscular atrophy
- HIV-associated lipodystrophy syndrome
- lupus nephritis
role in cell
- growth
- expression in
- proliferation
- outgrowth in
- outgrowth