The following mature miRNA have the same seed sequence: GUCUGCC
| ID | hsa-miR-346 |
| Accession | MIMAT0000773 |
| Sequence | 20 - UGUCUGCCCGCAUGCCUGCCUCU - 42 |
| Seed Sequence | GUCUGCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- lung cancer
- experimental autoimmune encephalomyelitis
- lupus nephritis
- cervical squamous cell carcinoma
- squamous cell cervical cancer
- polycystic kidney disease
regulated by
- rimonabant
- lipopolysaccharide
role in cell
- expression in
- growth
- migration
- invasion
- malignancy