The following mature miRNA have the same seed sequence: AAUGUUG
| ID | hsa-miR-409-3p |
| Accession | MIMAT0001639 |
| Sequence | 47 - GAAUGUUGCUCGGUGAACCCCU - 68 |
| Seed Sequence | AAUGUUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- systemic lupus erythematosus
- deep vein thrombosis
- idiopathic pulmonary fibrosis
- liposarcoma
- soft tissue sarcoma cancer
- experimental autoimmune encephalomyelitis
role in cell
- expression in
- proliferation
- apoptosis
- quantity
- invasion
- migration