The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-665 |
| Accession | MI0005563 |
| Genome Context | chr14: 100875033-100875104 [+] |
| Sequence | UCUCCUCGAGGGGUCUCUGCCUCUACCCAGGACUCUUUCAUGACCAGGAGGCUGAGGCCCCUCACAGGCGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- sporadic amyotrophic lateral sclerosis
- idiopathic pulmonary fibrosis
- dilated cardiomyopathy
role in cell
- expression in
- proliferation
- phosphorylation in
- migration
- cell cycle progression
- radiosensitivity
- response by
- invasion by