The following mature miRNA have the same seed sequence: ACCCGUA
| ID | hsa-miR-99a-5p |
| Accession | MIMAT0000097 |
| Sequence | 13 - AACCCGUAGAUCCGAUCUUGUG - 34 |
| Seed Sequence | ACCCGUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- epithelial cancer
- endometriosis
- non-insulin-dependent diabetes mellitus
- Alzheimer disease
- pancreatic cancer
- hepatocellular carcinoma
- liver cancer
- vulvar melanoma
- vulva cancer
role in cell
- phosphorylation in
- apoptosis
- expression in
- activation in
- differentiation
- growth
- migration
- invasion by
- cell cycle progression
- proliferation