The following mature miRNA have the same seed sequence: UGACCUA
| ID | hsa-miR-192-5p |
| Accession | MIMAT0000222 |
| Sequence | 24 - CUGACCUAUGAAUUGACAGCC - 44 |
| Seed Sequence | UGACCUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- breast cancer
- hepatocellular carcinoma
- liver cancer
- epithelial cancer
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- adult T-cell leukemia/lymphoma
role in cell
- proliferation
- growth
- activation in
- number
- expression in
- differentiation
- invasion by
- colony formation by
- sepantronium sensitivity