The following mature miRNA have the same seed sequence: CAGCAGG
| ID | hsa-miR-214-3p |
| Accession | MIMAT0000271 |
| Sequence | 71 - ACAGCAGGCACAGACAGGCAGU - 92 |
| Seed Sequence | CAGCAGG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- pancreatic cancer
- endometriosis
- adrenal cortex carcinoma
- adrenocortical carcinoma
- hypopharyngeal squamous cell carcinoma
- squamous cell cancer of the hypopharynx
- amyotrophic lateral sclerosis
- esophageal cancer
- gastric cancer
regulated by
- TNF
- D-glucose
- aldosterone
- cisplatin
- Human cytomegalovirus
- androgen
- FSH
- trichostatin A
- hydrogen peroxide
- tretinoin
role in cell
- expression in
- proliferation
- apoptosis
- growth in
- activation
- colony formation
- production in
- migration
- invasion by
- contractility