The following mature miRNA have the same seed sequence: AUUAUUA
| ID | hsa-miR-126-5p |
| Accession | MIMAT0000444 |
| Sequence | 15 - CAUUAUUACUUUUGGUACGCG - 35 |
| Seed Sequence | AUUAUUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- neoplasia
- plexiform neurofibroma
- non-small cell lung cancer
- ischemic cardiomyopathy
- dilated cardiomyopathy
- experimental autoimmune encephalomyelitis
- endometriosis
- aortic stenosis
- breast cancer
role in cell
- migration
- expression in
- proliferation
- apoptosis
- growth
- chemotaxis
- epithelial-mesenchymal transition
- dissemination
- invasion by
- activation in