The following mature miRNA have the same seed sequence: UUGUUCG
| ID | hsa-miR-375-3p |
| Accession | MIMAT0000728 |
| Sequence | 40 - UUUGUUCGUUCGGCUCGCGUGA - 61 |
| Seed Sequence | UUGUUCG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-insulin-dependent diabetes mellitus
- diabetes mellitus
- tongue squamous cell carcinoma
- tongue squamous cell cancer
role in cell
- migration
- expression in
- synthesis in
- proliferation
- invasion by
- colony formation by