The following mature miRNA have the same seed sequence: GAAACAU
| ID | hsa-miR-494-3p |
| Accession | MIMAT0002816 |
| Sequence | 48 - UGAAACAUACACGGGAAACCUC - 69 |
| Seed Sequence | GAAACAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-insulin-dependent diabetes mellitus
- cervical squamous cell carcinoma
- vaginal melanoma
- vaginal cancer
- melanoma cancer
- soft tissue cancer
- squamous cell cervical cancer
- organismal death
- immune thrombocytopenia
- amyotrophic lateral sclerosis
role in cell
- expression in
- phosphorylation in
- activation
- migration
- binding in
- osteoclastogenesis
- colony formation by