The following mature miRNA have the same seed sequence: AUGCCUU
| ID | hsa-miR-532-5p |
| Accession | MIMAT0002888 |
| Sequence | 20 - CAUGCCUUGAGUGUAGGACCGU - 41 |
| Seed Sequence | AUGCCUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- ulcerative colitis
- liver cancer
- epithelial cancer
- organismal death
- sporadic amyotrophic lateral sclerosis
- colorectal cancer
- nonobstructive azoospermia
- Dent disease
- hepatocellular carcinoma
- HER2 negative hormone receptor negative breast cancer
regulates
role in cell
- proliferation
- migration
- invasion by