The following mature miRNA have the same seed sequence: GUGACAG
| ID | hsa-miR-542-3p |
| Accession | MIMAT0003389 |
| Sequence | 53 - UGUGACAGAUUGAUAACUGAAA - 74 |
| Seed Sequence | GUGACAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- endometrial cancer
- colorectal cancer
- Waldenström macroglobulinemia
- endometriosis
- congenital adrenal hyperplasia
- metastatic colorectal cancer
- colon cancer
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
role in cell
- expression in
- interaction in
- cell proliferation
- mRNA decay in