Mirna Stemloop Summary
| id | hsa-mir-210 |
| Accession | MI0000286 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Its expression was later verified in human BC-1 cells [2]. |
| Description | Homo sapiens miR-210 stem-loop |
| Gene Family | MIPF0000086;mir-210 |
| Genome Context | chr11: 568089-568198 [-] |
| miRna Matures Links | |
| Sequence | ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC |