The following mature miRNA have the same seed sequence: UGUGCGU
| ID | hsa-miR-210-3p |
| Accession | MIMAT0000267 |
| Sequence | 66 - CUGUGCGUGUGACAGCGGCUGA - 87 |
| Seed Sequence | UGUGCGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- organismal death
- lung cancer
- Alzheimer disease
- breast cancer
- hepatocellular carcinoma
- liver cancer
- epithelial cancer
- lung squamous cell carcinoma
- squamous cell lung cancer
- preeclampsia
role in cell
- expression in
- apoptosis
- proliferation
- migration
- production in
- acidification
- replication in
- colony formation
- lysis
- hydroxylation in