The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-375 |
| Accession | MI0000783 |
| Genome Context | chr2: 219001645-219001708 [-] |
| Associated Mature miRNA | |
| Sequence | CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- vitiligo
- epithelial cancer
- neoplasia
- gastric cancer
- prostate cancer
- adrenal cortex carcinoma
- adrenocortical carcinoma
- tumorigenesis
- tongue squamous cell carcinoma
- tongue squamous cell cancer
role in cell
- expression in
- number
- proliferation
- apoptosis
- cell viability
- quantity
- differentiation
- growth
- migration
- sphere formation