The following mature miRNA have the same seed sequence: AGGAGCU
| ID | hsa-miR-28-5p |
| Accession | MIMAT0000085 |
| Sequence | 14 - AAGGAGCUCACAGUCUAUUGAG - 35 |
| Seed Sequence | AGGAGCU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- Parkinson disease
- breast cancer
- liver cancer
- chromosomal instability
- lung squamous cell carcinoma
- squamous cell lung cancer
- chronic epilepsy
- lung adenocarcinoma
- lung adenocarcinoma formation
role in cell
- apoptosis
- proliferation
- accumulation in
- expression in
- growth
- migration
- phosphorylation in
- production in
- missegregation
- invasion by