The following mature miRNA have the same seed sequence: UUUCAGU
| ID | hsa-miR-30a-3p |
| Accession | MIMAT0000088 |
| Sequence | 47 - CUUUCAGUCGGAUGUUUGCAGC - 68 |
| Seed Sequence | UUUCAGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- precursor B-cell acute lymphoblastic leukemia
- hypopharyngeal squamous cell carcinoma
- squamous cell cancer of the hypopharynx
- idiopathic pulmonary fibrosis
- cervical squamous cell carcinoma
- squamous cell cervical cancer
- dermatomyositis
- limb-girdle muscular dystrophy type 2A
- colorectal cancer
- nemaline myopathy
role in cell
- expression in
- proliferation
- quantity
- downregulation in
- apoptosis
- growth