The following mature miRNA have the same seed sequence: UCACCAC
| ID | hsa-miR-197-3p |
| Accession | MIMAT0000227 |
| Sequence | 48 - UUCACCACCUUCUCCACCCAGC - 69 |
| Seed Sequence | UCACCAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- Alzheimer disease
- nasopharyngeal cancer
- neoplasia
- uterine leiomyoma
- polycystic ovary syndrome
- epithelial cancer
- non-small cell lung cancer
- leiomyomatosis
- LMNA-related congenital muscular dystrophy
- idiopathic pulmonary fibrosis
role in cell
- growth
- cell viability
- expression in
- migration
- proliferation
- apoptosis
- autophagy in
- gefitinib resistance
- cisplatin resistance
- radiosensitivity