The following mature miRNA have the same seed sequence: CAGUGCA
| ID | hsa-miR-148a-3p |
| Accession | MIMAT0000243 |
| Sequence | 44 - UCAGUGCACUACAGAACUUUGU - 65 |
| Seed Sequence | CAGUGCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- epithelial cancer
- gastric cancer
- colorectal cancer
- pancreatic cancer
- hepatocellular carcinoma
- pancreatic ductal adenocarcinoma
- HER2 negative hormone receptor negative breast cancer
- non-insulin-dependent diabetes mellitus
- diabetes mellitus
role in cell
- expression in
- apoptosis
- proliferation
- phosphorylation in
- cell viability
- synthesis in
- migration
- colony formation
- Gap 0-Gap 1 phase
- cytokinesis