The following mature miRNA have the same seed sequence: UGAAAUG
| ID | hsa-miR-203a-3p |
| Accession | MIMAT0000264 |
| Sequence | 65 - GUGAAAUGUUUAGGACCACUAG - 86 |
| Seed Sequence | UGAAAUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- cervical squamous cell carcinoma
- squamous cell lung cancer
- metastasis
- esophageal squamous cell carcinoma
- neoplasia
- lung squamous cell carcinoma
- esophageal squamous cell cancer
- squamous cell cancer of the hypopharynx
- metastatic melanoma
- epithelial cancer
role in cell
- cell viability
- migration
- morphology
- expression in
- apoptosis
- proliferation
- phosphorylation in
- activation in
- repression in
- cell cycle progression