The following mature miRNA have the same seed sequence: GGAAUGU
| ID | hsa-miR-1-3p |
| Accession | MIMAT0000416 |
| Sequence | 53 - UGGAAUGUAAAGAAGUAUGUAU - 74 |
| Seed Sequence | GGAAUGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- Alzheimer disease
- non-insulin-dependent diabetes mellitus
- coronary artery disease
- amyotrophic lateral sclerosis
- organismal death
- prostate cancer
- liver cancer
- acute myocardial infarction
- soft tissue sarcoma cancer
- myocardial ischemia
role in cell
- expression in
- cell viability
- phosphorylation in
- proliferation
- apoptosis
- formation
- quantity
- re-innervation
- handling in
- glycolysis in