The following mature miRNA have the same seed sequence: GCUGGUG
| ID | hsa-miR-138-5p |
| Accession | MIMAT0000430 |
| Sequence | 10 - AGCUGGUGUUGUGAAUCAGGCCG - 32 |
| Seed Sequence | GCUGGUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- metastasis
- ulcerative colitis
- psoriasis
- organismal death
- papillary thyroid carcinoma
- papillary thyroid cancer
- colorectal carcinomagenesis
- lung cancer
- renal clear cell adenocarcinoma
role in cell
- apoptosis
- expression in
- production in
- growth
- volume
- invasion by