The following mature miRNA have the same seed sequence: CGUACCG
| ID | hsa-miR-126-3p |
| Accession | MIMAT0000445 |
| Sequence | 52 - UCGUACCGUGAGUAAUAAUGCG - 73 |
| Seed Sequence | CGUACCG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- non-insulin-dependent diabetes mellitus
- endometriosis
- idiopathic pulmonary fibrosis
- breast cancer
- dilated cardiomyopathy
- liver cancer
- myelodysplastic syndrome with isolated del(5q)
- diabetes mellitus
- lung cancer
role in cell
- proliferation
- expression in
- invasion by