The following mature miRNA have the same seed sequence: GUAACAG
| ID | hsa-miR-194-5p |
| Accession | MIMAT0000460 |
| Sequence | 15 - UGUAACAGCAACUCCAUGUGGA - 36 |
| Seed Sequence | GUAACAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- neoplasia
- endometriosis
- cervical squamous cell carcinoma
- squamous cell cervical cancer
- fibrosis
- experimental autoimmune encephalomyelitis
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
role in cell
- expression in
- activation in
- proliferation
- apoptosis
- cell death
- migration
- invasion by