The following mature miRNA have the same seed sequence: CAAGAGC
| ID | hsa-miR-335-5p |
| Accession | MIMAT0000765 |
| Sequence | 16 - UCAAGAGCAAUAACGAAAAAUGU - 38 |
| Seed Sequence | CAAGAGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-insulin-dependent diabetes mellitus
- breast cancer
- liver cancer
- polycystic kidney disease
- renal clear cell adenocarcinoma
- renal clear cell cancer
- hyperglycemia
- nonalcoholic fatty liver disease
- late-onset preeclampsia
- idiopathic pulmonary fibrosis
role in cell
- proliferation
- expression in
- migration
- epithelial-mesenchymal transition