The following mature miRNA have the same seed sequence: AUCGUAC
| ID | hsa-miR-487b-3p |
| Accession | MIMAT0003180 |
| Sequence | 51 - AAUCGUACAGGGUCAUCCACUU - 72 |
| Seed Sequence | AUCGUAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- colorectal cancer
- colon adenocarcinoma
- colon epithelial cancer
- primary myelofibrosis
- pilocarpine-induced status epilepticus
- chronic epilepsy
- kainic acid-induced epileptic seizure
role in cell
- apoptosis
- expression in
- growth