The following mature miRNA have the same seed sequence: GAGGGGC
| ID | hsa-miR-423-5p |
| Accession | MIMAT0004748 |
| Sequence | 17 - UGAGGGGCAGAGAGCGAGACUUU - 39 |
| Seed Sequence | GAGGGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- primary open-angle glaucoma
- gastric cancer
- insulin resistance
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- colorectal cancer
- breast cancer
- aortic stenosis
- glioblastoma
role in cell
- apoptosis
- expression in
- proliferation
- migration
- invasion by