The following mature miRNA have the same seed sequence: AAUUUUA
| ID | hsa-miR-590-3p |
| Accession | MIMAT0004801 |
| Sequence | 56 - UAAUUUUAUGUAUAAGCUAGU - 76 |
| Seed Sequence | AAUUUUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- epithelial cancer
- HER2 negative hormone receptor negative breast cancer
- hepatocellular carcinoma
- nonobstructive azoospermia
regulated by
role in cell
- migration
- invasion by
- expression in
- proliferation
- cell cycle progression
- synthesis in
- cytokinesis