The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-132 |
| Accession | MI0000449 |
| Genome Context | chr17: 2049908-2050008 [-] |
| Associated Mature miRNA | |
| Sequence | CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUAACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- fragile X syndrome
- seizures
- polymyositis
- dermatomyositis
- sporadic amyotrophic lateral sclerosis
- colorectal cancer
- Alzheimer disease
- epithelial cancer
- diabetes mellitus
- lymphoma
role in cell
- production in
- cell death
- proliferation
- expression in
- phosphorylation in
- activation in
- growth
- cell cycle progression
- apoptosis
- migration