The following mature miRNA have the same seed sequence: AACAGUC
| ID | hsa-miR-132-3p |
| Accession | MIMAT0000426 |
| Sequence | 59 - UAACAGUCUACAGCCAUGGUCG - 80 |
| Seed Sequence | AACAGUC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-insulin-dependent diabetes mellitus
- diabetes mellitus
- sporadic amyotrophic lateral sclerosis
- Alzheimer disease
- schizophrenia
- endometriosis
- kainic acid-induced epileptic seizure
- liver cancer
- B cell cancer
- primary melanoma
role in cell
- apoptosis
- expression in
- proliferation
- damage
- development
- accumulation in
- sprouting
- G2/M phase
- transition
- number