The following mature miRNA have the same seed sequence: GUGCAAA
| ID | hsa-miR-19a-3p |
| Accession | MIMAT0000073 |
| Sequence | 49 - UGUGCAAAUCUAUGCAAAACUGA - 71 |
| Seed Sequence | GUGCAAA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- dexamethasone
- IL6
- T lymphocytes
- decitabine
- hydrogen peroxide
- sirolimus
- acetaminophen
- Hct 116 cells
- trichostatin A
- iron sucrose
disease
- neoplasia
- rheumatoid arthritis
- non-insulin-dependent diabetes mellitus
- melanoma cancer
- lung cancer
- primary myelofibrosis
- early rheumatoid arthritis
- Alzheimer disease
- small cell lung cancer
- breast cancer
role in cell
- expression in
- proliferation
- phosphorylation in
- migration
- activation in
- growth
- colony formation by
- suppression
- consumption in
- glycolysis in