The following mature miRNA have the same seed sequence: AGCUUAU
| ID | hsa-miR-21-5p |
| Accession | MIMAT0000076 |
| Sequence | 8 - UAGCUUAUCAGACUGAUGUUGA - 29 |
| Seed Sequence | AGCUUAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- fibrosis
- neoplasia
- adenoma formation
- cancer
- epithelial cancer
- soft tissue sarcoma cancer
- metastasis
- T-cell non-Hodgkin disease
- hepatocellular carcinoma
- liver cancer
role in cell
- cell death
- cell viability
- expression in
- proliferation
- production in
- phosphorylation in
- apoptosis
- migration
- growth
- upregulation in