The following mature miRNA have the same seed sequence: GUAAACA
| ID | hsa-miR-30a-5p |
| Accession | MIMAT0000087 |
| Sequence | 6 - UGUAAACAUCCUCGACUGGAAG - 27 |
| Seed Sequence | GUAAACA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- schizophrenia
- colorectal cancer
- prostate cancer
- dilated cardiomyopathy
- breast carcinoma
- pancreatic cancer
- Alzheimer disease
- liver cancer
- epithelial cancer
- organismal death
role in cell
- proliferation
- expression in
- apoptosis
- phosphorylation in
- cell viability
- invasion by
- production in
- differentiation
- migration
- area