The following mature miRNA have the same seed sequence: ACAUUCA
| ID | hsa-miR-181a-5p |
| Accession | MIMAT0000256 |
| Sequence | 39 - AACAUUCAACGCUGUCGGUGAGU - 61 |
| Seed Sequence | ACAUUCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- cirrhosis
- epithelial cancer
- liver cancer
- pancreatic cancer
- survival
- prostate cancer
- organismal death
- acute myeloid leukemia
- nonobstructive azoospermia
- nonfamilial Alzheimer disease
role in cell
- activation in
- expression in
- apoptosis
- proliferation
- migration
- downregulation in
- growth
- invasion by
- cell proliferation
- sphere-forming efficiency