The following mature miRNA have the same seed sequence: UUGGUCC
| ID | hsa-miR-133a-3p |
| Accession | MIMAT0000427 |
| Sequence | 53 - UUUGGUCCCCUUCAACCAGCUG - 74 |
| Seed Sequence | UUGGUCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- fibrosis
- neoplasia
- bipolar disorder
- coronary artery disease
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- colorectal cancer
- prostate cancer
- cervical carcinoma
role in cell
- differentiation
- number
- expression in
- phosphorylation in
- proliferation
- migration
- survival
- accumulation in
- colony formation by
- hypertrophy