The following mature miRNA have the same seed sequence: CUUUGGU
| ID | hsa-miR-9-5p |
| Accession | MIMAT0000441 |
| Sequence | 16 - UCUUUGGUUAUCUAGCUGUAUGA - 38 |
| Seed Sequence | CUUUGGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- endometriosis
- renal clear cell adenocarcinoma
- cervical squamous cell carcinoma
- neoplasia
- malignant mesothelioma
- gallbladder cancer
- colorectal cancer
- epithelial cancer
- HER2 negative hormone receptor negative breast cancer
- Alzheimer disease
role in cell
- activation in
- expression in
- proliferation
- formation
- formation in
- apoptosis
- production in
- number
- conversion
- migration