The following mature miRNA have the same seed sequence: CGGAUCC
| ID | hsa-miR-127-3p |
| Accession | MIMAT0000446 |
| Sequence | 57 - UCGGAUCCGUCUGAGCUUGGCU - 78 |
| Seed Sequence | CGGAUCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- breast cancer
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- liposarcoma
- soft tissue sarcoma cancer
- non-insulin-dependent diabetes mellitus
- infantile hemangioma formation
- idiopathic pulmonary fibrosis
- congenital adrenal hyperplasia