The following mature miRNA have the same seed sequence: CCAGCAU
| ID | hsa-miR-338-3p |
| Accession | MIMAT0000763 |
| Sequence | 42 - UCCAGCAUCAGUGAUUUUGUUG - 63 |
| Seed Sequence | CCAGCAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- experimental autoimmune encephalomyelitis
- amyotrophic lateral sclerosis
- liver cancer
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
- sporadic amyotrophic lateral sclerosis
- prostate cancer
- ovarian failure
role in cell
- apoptosis
- expression in
- production in
- migration
- quantity
- proliferation
- invasion by
- transmembrane potential