The following mature miRNA have the same seed sequence: CACUCCU
| ID | hsa-miR-483-3p |
| Accession | MIMAT0002173 |
| Sequence | 48 - UCACUCCUCUCCUCCCGUCUU - 68 |
| Seed Sequence | CACUCCU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- epithelial cancer
- hepatocellular carcinoma
- malignant mesothelioma
- mesothelioma formation
- Wilms tumor
- Wilms tumorigenesis
- colorectal carcinoma
- colorectal carcinomagenesis
- colorectal cancer
role in cell
- proliferation
- apoptosis
- expression in
- migration
- differentiation
- number
- downregulation in
- colony formation
- tumorigenicity
- development