The following mature miRNA have the same seed sequence: CCUGUAC
| ID | hsa-miR-486-5p |
| Accession | MIMAT0002177 |
| Sequence | 4 - UCCUGUACUGAGCUGCCCCGAG - 25 |
| Seed Sequence | CCUGUAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- gallbladder cancer
- primary open-angle glaucoma
- prostate cancer
- lung adenocarcinoma
- lung adenocarcinoma formation
- papillary thyroid carcinoma
- papillary thyroid cancer
- dilated cardiomyopathy
- idiopathic pulmonary fibrosis
role in cell
- growth
- expression in
- apoptosis
- number
- signaling in
- differentiation
- self-renewal
- survival
- downregulation in
- cisplatin sensitivity