The following mature miRNA have the same seed sequence: ACCACAG
| ID | hsa-miR-140-3p |
| Accession | MIMAT0004597 |
| Sequence | 62 - UACCACAGGGUAGAACCACGG - 82 |
| Seed Sequence | ACCACAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- bipolar disorder
- ischemic cardiomyopathy
- idiopathic pulmonary fibrosis
- colorectal adenocarcinoma
- colorectal carcinomagenesis
- dilated cardiomyopathy
role in cell
- expression in
- migration
- proliferation
- invasion by