The following mature miRNA have the same seed sequence: AGACGGG
| ID | hsa-miR-483-5p |
| Accession | MIMAT0004761 |
| Sequence | 8 - AAGACGGGAGGAAAGAAGGGAG - 29 |
| Seed Sequence | AGACGGG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- metastasis
- colorectal cancer
- pulmonary fibrosis
- spinal muscular atrophy
- intrahepatic cholestasis of pregnancy
role in cell
- apoptosis
- expression in
- epithelial to mesenchymal transdifferentiation
- epithelial-mesenchymal transition
- maximal oxygen consumption rate
- glycolysis in
- invasion
- mitochondrial fission in
- basal oxygen consumption rate