The following mature miRNA have the same seed sequence: AGCUGCC
| ID | hsa-miR-22-3p |
| Accession | MIMAT0000077 |
| Sequence | 53 - AAGCUGCCAGUUGAAGAACUGU - 74 |
| Seed Sequence | AGCUGCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- cholangiocarcinoma
- cholangiocarcinoma cancer
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- breast cancer
- liver cancer
- Alzheimer disease
- colorectal cancer
- sporadic amyotrophic lateral sclerosis
role in cell
- expression in
- phosphorylation in
- invasion by
- migration
- proliferation
- epithelial-mesenchymal transition
- malignancy