The following mature miRNA have the same seed sequence: UCAAGUA
| ID | hsa-miR-26a-5p |
| Accession | MIMAT0000082 |
| Sequence | 10 - UUCAAGUAAUCCAGGAUAGGCU - 31 |
| Seed Sequence | UCAAGUA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver neoplasia
- neoplasia
- metastasis
- liver cancer
- epithelial cancer
- glioblastoma
- glioblastoma cancer
- Alzheimer disease
- breast cancer
- cancer
role in cell
- expression in
- apoptosis
- formation
- activation in
- growth
- cell cycle progression
- proliferation
- phosphorylation in
- cell viability
- differentiation