The following mature miRNA have the same seed sequence: CCUUCAU
| ID | hsa-miR-205-5p |
| Accession | MIMAT0000266 |
| Sequence | 34 - UCCUUCAUUCCACCGGAGUCUG - 55 |
| Seed Sequence | CCUUCAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- metastatic melanoma
- neoplasia
- organismal death
- metastasis
- metastatic melanoma cancer
- psoriasis
- polycystic ovary syndrome
- diabetes mellitus
- melanoma cancer
- pancreatic epithelial cancer
role in cell
- phosphorylation in
- activation in
- expression in
- migration
- proliferation
- apoptosis
- binding in
- cell cycle progression
- morphology
- invasion by