The following mature miRNA have the same seed sequence: GCUACAU
| ID | hsa-miR-221-3p |
| Accession | MIMAT0000278 |
| Sequence | 65 - AGCUACAUUGUCUGCUGGGUUUC - 87 |
| Seed Sequence | GCUACAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- diabetes mellitus
- non-insulin-dependent diabetes mellitus
- cystic fibrosis
- hepatocellular carcinoma
- liver cancer
- epithelial cancer
- lung cancer
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
role in cell
- expression in
- survival
- proliferation
- apoptosis
- cell death
- growth
- migration
- cytotoxic reaction
- number
- lymphangiogenesis