The following mature miRNA have the same seed sequence: GAGAUGA
| ID | hsa-miR-143-3p |
| Accession | MIMAT0000435 |
| Sequence | 61 - UGAGAUGAAGCACUGUAGCUC - 81 |
| Seed Sequence | GAGAUGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- hepatocellular carcinoma
- liver cancer
- non-insulin-dependent diabetes mellitus
- colorectal cancer
- pancreatic ductal adenocarcinoma
- pancreatic epithelial cancer
- ductal pancreatic cancer
- breast cancer
- esophageal squamous cell carcinoma
role in cell
- expression in
- apoptosis
- proliferation
- migration
- cell death
- cell viability
- formation
- autophagy in
- growth
- differentiation