The following mature miRNA have the same seed sequence: ACAGUAU
| ID | hsa-miR-144-3p |
| Accession | MIMAT0000436 |
| Sequence | 52 - UACAGUAUAGAUGAUGUACU - 71 |
| Seed Sequence | ACAGUAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- uterine leiomyoma
- leiomyomatosis
- liposarcoma
- soft tissue sarcoma cancer
- primary open-angle glaucoma
- colon carcinoma
- colon epithelial cancer
- postmenopausal osteoporosis
- rhabdomyosarcoma
- chronic obstructive pulmonary disease
role in cell
- expression in
- activation in
- production in
- migration
- apoptosis
- proliferation
- growth
- quantity
- differentiation
- epithelial-mesenchymal transition