The following mature miRNA have the same seed sequence: AAAGCUG
| ID | hsa-miR-320a-3p |
| Accession | MIMAT0000510 |
| Sequence | 42 - AAAAGCUGGGUUGAGAGGGCGA - 63 |
| Seed Sequence | AAAGCUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- experimental autoimmune encephalomyelitis
- non-insulin-dependent diabetes mellitus
- epithelial cancer
- nasopharyngeal carcinoma
- nasopharyngeal cancer
- pilocarpine-induced status epilepticus
- infarction
- kainic acid-induced epileptic seizure
- lupus nephritis
role in cell
- expression in
- cell death
- apoptosis
- proliferation
- migration
- downregulation in